400 size baitcasting reel X-Series Low Profile Baitcast Color:Parrot Rod & Reel Outfit / Combo Best Bass Fishing Rigs, Featuring a large single
Best Bass Fishing Rigs, Setups and Techniques
CTCGTCTATTGGCCCCTGTAGAAAGT cerevisiae)-like 1 (SEC22L1), mRNA TAACCTTTGTTGTTTTCCTTTTAT /cds=(119,766) 656 Table 3A Hs.40323 AF047472 2921872 BUB3 (budding uninhibited by TCCCCTTCTGTCCCCTAGTAAGCCCA benzimidazoles 3, yeast) homolog GTTGCTGTATCTGAACAGTTTGAG (BUB3), mRNA /cds=(70,1056) 657 Table 3A Hs.26584 AF051782 29 4 7237 diaphanous 1 (HDIA1) mRNA, AAACCTATTTCCCTTGCCTCATAGGC complete cds /cds=(0,3746) TTCTGGGATGTCATCACCTCCAGT 658 Table 3A Hs.313 AF052124 3360 4 31 secreted phosphoprotein 1 GAATTTGGTGGTGTCAATTGCTTATTT (osteopontin, bone sialoprotein I, early T- GTTTTCCCACGGTTGTCCAGCAA lymphocyte activation 1) (SPP1), mRNA /cds=(87,989) 659 Table 3A Hs.227949 AF052155 3360466 SEC13 (S
Rod & Reel Outfit / Combo
Color:Parrot
Heater’s products, which offer an automatic low oxygen depletion sensor and an accidental tip-over safety shut-off
Featuring a large single EVA knob
